Search Results | SCGE Toolkit

SCGE Consortium Home | About SCGE Toolkit | Contact Us | Citing the Toolkit | License

Filter By ...

Animal (12)

Mouse (11)

Rhesus macaque (1)

Transgene Reporter

tdTomato (4)

tdTomato and EGFP (1)

tdTomato/GFP double reporter (1)

Table View
List View

12 results for search term 'Epithelium' in category Model System

BALB/c mouse Model System - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: category : Model System tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium BALB/cJ is a commonly used inbred. Key traits include a susceptibility to developing the demyelinating disease upon infection with Theiler's murine encephalomyelitis virus. The BALB/cJ substrain is susceptible to Listeria, all species of Leishmania, and several species of Trypanosoma, but is resistant to experimental allergic orchitis (EAO). Show Experiments (1) Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia.
mTmG mouse Model System - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: category : Model System tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium ROSAmT/mG is a cell membrane-targeted, two-color fluorescent Cre-reporter allele. Prior to Cre recombination, cell membrane-localized tdTomato (mT) fluorescence expression is widespread in cells/tissues. Cre recombinase expressing cells (and future cell lineages derived from these cells) have cell membrane-localized EGFP (mG) fluorescence expression replacing the red fluorescence Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
Ai9 mouse (BCM) Model System - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: category : Model System tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. Show Experiments (2) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
B6 Model System - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: category : Model System termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium C57BL/6J WT mouse Show Experiments (1) Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver
C57BL/6 mouse (Asokan study) Model System - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: category : Model System termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Show Experiments (2) Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
Ai14 mouse Model System - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: category : Model System termSynonyms : Ecto-epithelium Epithelium Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. Show Experiments (1) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.
Macaca mulatta (Rhesus Macaque) Model System - [In Vivo] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Rhesus macaque] Matched Fields: category : Model System tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium Show Experiments (1) Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
mTmG mouse (congenic) Model System - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: category : Model System tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Ecto-epithelium Meso-epithelium Lung epithelium Epithelium Endo-epithelium mTmG is a double-fluorescent reporter transgenic mouse which expresses membrane-targeted tdTomato flanked by loxP sequences, followed by membrane-targeted GFP. After genomic cleavage by Cas9 at two sites, or Cre recombinase between loxP sites, tdTomato expression is lost and GFP is expressed. Show Experiments (7) Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
Ai9 mouse Model System - [In Vivo] [Delivery Systems, AAV tropism, Animal Reporter and Testing Center] [Mouse] Matched Fields: category : Model System tissueTerm : Epithelium of main bronchus Epithelium of bronchus termSynonyms : Ecto-epithelium Ciliated epithelium Meso-epithelium Epithelium Endo-epithelium Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. Show Experiments (11) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Testing AAV5 for activation of tdTomato in mouse airway Cre Recombinase dose escalation study in Ai9 mice Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain FUS (focused ultrasound) array validation in Ai9 mice Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells AAV Tropism project
Ai9-SauSpyCas9 mouse Model System - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: category : Model System tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
C57BL/6J mouse Model System - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: category : Model System termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium C57BL/6J WT mouse Show Experiments (3) Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Pcsk9 adenine base editor efficiency in liver and nonliver tissue On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver
Ai14 mouse (congenic) Model System - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: category : Model System termSynonyms : Ecto-epithelium Meso-epithelium Kidney epithelium Epithelium Endo-epithelium Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. Show Experiments (7) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain

12 results for search term 'Epithelium' in category Model System

Type	Organism	Subtype	Name	Description	Source	View Associated...
Animal	Mouse		BALB/c mouse	BALB/cJ is a commonly used inbred. Key traits include a susceptibility to developing the demyelinating disease upon infection with Theiler's murine encephalomyelitis virus. The BALB/cJ substrain is susceptible to Listeria, all species of Leishmania, and several species of Trypanosoma, but is resistant to experimental allergic orchitis (EAO).	The Jackson Laboratory	Show Experiments (1) Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia.
Animal	Mouse		mTmG mouse	ROSAmT/mG is a cell membrane-targeted, two-color fluorescent Cre-reporter allele. Prior to Cre recombination, cell membrane-localized tdTomato (mT) fluorescence expression is widespread in cells/tissues. Cre recombinase expressing cells (and future cell lineages derived from these cells) have cell membrane-localized EGFP (mG) fluorescence expression replacing the red fluorescence	The Jackson Laboratory	Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
Animal	Mouse		Ai9 mouse (BCM)	Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.	Baylor College of Medicine	Show Experiments (2) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Animal	Mouse		B6	C57BL/6J WT mouse	Baylor College of Medicine	Show Experiments (1) Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver
Animal	Mouse		C57BL/6 mouse (Asokan study)		Unspecified	Show Experiments (2) Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
Animal	Mouse		Ai14 mouse	Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain.	The Jackson Laboratory	Show Experiments (1) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.
Animal	Rhesus macaque		Macaca mulatta (Rhesus Macaque)		Tarantal Lab	Show Experiments (1) Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
Animal	Mouse		mTmG mouse (congenic)	mTmG is a double-fluorescent reporter transgenic mouse which expresses membrane-targeted tdTomato flanked by loxP sequences, followed by membrane-targeted GFP. After genomic cleavage by Cas9 at two sites, or Cre recombinase between loxP sites, tdTomato expression is lost and GFP is expressed.	The Jackson Laboratory	Show Experiments (7) Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
Animal	Mouse		Ai9 mouse	Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.	The Jackson Laboratory	Show Experiments (11) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Testing AAV5 for activation of tdTomato in mouse airway Cre Recombinase dose escalation study in Ai9 mice Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain FUS (focused ultrasound) array validation in Ai9 mice Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells AAV Tropism project
Animal	Mouse		Ai9-SauSpyCas9 mouse	Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression.	Baylor College of Medicine	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Animal	Mouse		C57BL/6J mouse	C57BL/6J WT mouse	The Jackson Laboratory	Show Experiments (3) Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Pcsk9 adenine base editor efficiency in liver and nonliver tissue On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver
Animal	Mouse		Ai14 mouse (congenic)	Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain.	The Jackson Laboratory	Show Experiments (7) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain